UNC1999

Catalog No.S7165 Batch:S716507

Print

Technical Data

Formula

C33H43N7O2

Molecular Weight 569.74 CAS No. 1431612-23-5
Solubility (25°C)* In vitro DMSO 100 mg/mL (175.51 mM)
Ethanol 25 mg/mL (43.87 mM)
Water Insoluble
* <1 mg/ml means slightly soluble or insoluble.
* Please note that Selleck tests the solubility of all compounds in-house, and the actual solubility may differ slightly from published values. This is normal and is due to slight batch-to-batch variations.
* Room temperature shipping (Stability testing shows this product can be shipped without any cooling measures.)

Preparing Stock Solutions

Biological Activity

Description UNC1999 is a potent, orally bioavailable and selective inhibitor of EZH2 and EZH1 with IC50 of 2 nM and 45 nM in cell-free assays, respectively, showing >1000-fold selectivity over a broad range of epigenetic and non-epigenetic targets. UNC1999 is a potent autophagy inducer. UNC1999 specifically suppresses H3K27me3/2 and induces a range of anti-leukemia effects including anti-proliferation, differentiation, and apoptosis.
Targets
EZH2 [2]
(Cell-free assay)
EZH1 [2]
(Cell-free assay)
2 nM 45 nM
In vitro UNC1999 is highly potent for both EZH2 Y641N and EZH2 Y641F mutants in vitro. UNC1999 causes concentration-dependent reductions of H3K27me3 in MCF10A cells with IC50 of 124 nM , while shows low cellular toxicity. UNC1999 displays potent, concentration-dependent inhibition of cell proliferation with EC50 of 633 nM in a DLBCL cell line harboring the EZH2Y641N mutant. In addition, biotinylated UNC1999 enriches EZH2 from HEK293T cell lysates, and thus may be used in chemoproteomics studies. [1]
In vivo Treatment of UNC1999 (150 and 50 mg/kg, i.p.) results in the plasma concentrations of UNC1999 above its cellular IC50 over 24 hours in vivo. In addition, UNC1999 is also orally bioavailable in mice, which makes chronic animal studies more practical and convenient. [1]
Features The first orally bioavailable inhibitor against wild-type and mutant EZH2 as well as EZH1.

Protocol (from reference)

Kinase Assay:

[1]

  • Scintillation Proximity Assay

    Methyltransferase activity assays are performed by monitoring the incorporation of tritiumlabeled methyl group from S-adenosylmethionine (3H-SAM) to biotinylated peptide substrates using Scintillation Proximity Assay (SPA) for PRC2-EZH2 trimeric complex (EZH2:EED:SUZ12), PRC2-EZH1 pentameric complex (EZH1:EED:SUZ12:RBBP4:AEBP2), SETD7, G9a, GLP, SETDB1, SETD8, SUV420H1, SUV420H2, SUV39H2, MLL1 tetrameric complex (MLL:WDR5:RbBP5:ASH2L), PRMT1, PRMT3, PRMT5-MEP50 complex and SMYD2. The reaction buffer for SMYD2 and SMYD3 is 50 mM Tris pH 9.0, 5 mM DTT, 0.01% TritonX-100; for G9a, GLP and SUV39H2 is 25 mM potassium phosphate pH 8.0, 1 mM EDTA, 2 mM MgCl2 and 0.01% Triton X-100; and for other HMTs 20 mM Tris pH 8.0, 5 mM DTT, 0.01% TritonX-100. To stop the enzymatic reactions, 10 μL of 7.5 M guanidine hydrochloride is added, followed by 180 μL of buffer, mixed and transferred to a 384-well FlashPlate. After mixing, the reaction mixtures are incubated and the CPM counts are measured using Topcount plate reader. The CPM counts in the absence of compound for each data set are defined as 100% activity. In the absence of the enzyme, the CPM counts in each data set are defined as background (0%). IC50 values are determined using compound concentrations ranging from 100 nM to 100 μM. The IC50 values are determined using SigmaPlot software. EZH2-Y641F assays are performed using 30 nM of enzyme in 20 mM Tris pH 8, 5 mM DTT, 0.01% Triton X-100, 5 μM SAM and 1 μM of H3 (1-24) peptide (same as for the wild-type PRC2-EZH2 complex). For DNMT1, the assay is performed using hemimethylated dsDNA as a substrate. The dsDNA substrate is prepared by annealing two complementary strands (biotintlated forward strand: BGAGCCCGTAAGCCCGTTCAGGTCG and reverse strand: CGACCTGAACGGGCTTACGGGCTC), synthesized by Eurofins MWG Operon. Reaction buffer is 20 mM Tris-HCl, pH 8.0, 5mM DTT, 0.01% Triton X-100. Methyltransferase activity assays for DOT1L is performed using Filter-plates. Reaction mixtures in 20 mM Tris-HCl, pH 8.0, 5 mM DTT, 2 mM MgCl2 and 0.01% Triton X-100 are incubated at room temperature for 1h, 100 μL 10% TCA is added, mixed and transferred to filter-plate. Plates are centrifuged at 2000 rpm for 2 min followed by 2 additional 10% TCA wash and one ethanol wash (180 μL) followed by centrifugation. Plates are dried and 100 μL MicroO is added and centrifuged. 70 μL MicroO is added and CPM are measured using Topcount plate reader.

Cell Assay:

[1]

  • Cell lines

    DLBCL cell line harboring the EZH2Y641N mutant

  • Concentrations

    ~5 μM

  • Incubation Time

    8 days

  • Method

    DB cells, a diffuse-large B-cell lymphoma cell line harboring the EZH2 Y641N mutation, are obtained from ATCC and cultured in RPMI 1640 supplemented with 10% fetal bovine serum, antibiotics, and various concentrations of compounds (DMSO control, UNC1999, or UNC2400). The medium containing the test compound or control is refreshed every 3 days. The numbers of viable cells from at least three independent experiments are measured using TC20 automated cell counter system. Total histones are prepared from cell nuclei using an acidic extraction protocol. About 1 μg of total histones is separated using 15% SDS-PAGE, transferred to PVDF membranes, and probed with histone antibodies. Antibodies used in this study are those against EZH2, general H3, and H3K27me3.

Animal Study:

[1]

  • Animal Models

    Male Swiss albino mice

  • Dosages

    ~150 mg/kg (i.p.), ~50 mg/kg (oral)

  • Administration

    Intraperitoneal administration or oral administration

Customer Product Validation

Data from [Data independently produced by , , Oncogene, 2015, 10.1038/onc.2015.38]

Data from [Data independently produced by , , Oncotarget, 2016, 7(37):59360-59376]

Selleck's UNC1999 has been cited by 30 publications

LSD1 inhibition improves efficacy of adoptive T cell therapy by enhancing CD8+ T cell responsiveness [ Nat Commun, 2024, 15(1):7366] PubMed: 39191730
Hedgehog pathway orchestrates the interplay of histone modifications and tailors combination epigenetic therapies in breast cancer [ Acta Pharm Sin B, 2023, 13(6):2601-2612] PubMed: 37425067
Hedgehog pathway orchestrates the interplay of histone modifications and tailors combination epigenetic therapies in breast cancer [ Acta Pharm Sin B, 2023, 13(6):2601-2612] PubMed: 37425067
EZH2-H3K27me3-mediated silencing of mir-139-5p inhibits cellular senescence in hepatocellular carcinoma by activating TOP2A [ J Exp Clin Cancer Res, 2023, 42(1):320] PubMed: 38008711
BRD4770 functions as a novel ferroptosis inhibitor to protect against aortic dissection [ Pharmacol Res, 2022, 177:106122] PubMed: 35149187
Dual targeting of EZH1 and EZH2 for the treatment of malignant rhabdoid tumors [ Mol Ther Oncolytics, 2022, 27:14-25] PubMed: 36212776
Enhanced Calcium Signal Induces NK Cell Degranulation but Inhibits Its Cytotoxic Activity [ J Immunol, 2022, 208(2):347-357] PubMed: 34911773
HBV covalently closed circular DNA minichromosomes in distinct epigenetic transcriptional states differ in their vulnerability to damage [ Hepatology, 2021, 10.1002/hep.32245] PubMed: 34779008
HBV covalently closed circular DNA minichromosomes in distinct epigenetic transcriptional states differ in their vulnerability to damage [ Hepatology, 2021, 10.1002/hep.32245] PubMed: 34779008
SChLAP1 promotes prostate cancer development through interacting with EZH2 to mediate promoter methylation modification of multiple miRNAs of chromosome 5 with a DNMT3a-feedback loop [ Cell Death Dis, 2021, 12(2):188] PubMed: 33589600

RETURN POLICY
Selleck Chemical’s Unconditional Return Policy ensures a smooth online shopping experience for our customers. If you are in any way unsatisfied with your purchase, you may return any item(s) within 7 days of receiving it. In the event of product quality issues, either protocol related or product related problems, you may return any item(s) within 365 days from the original purchase date. Please follow the instructions below when returning products.

SHIPPING AND STORAGE
Selleck products are transported at room temperature. If you receive the product at room temperature, please rest assured, the Selleck Quality Inspection Department has conducted experiments to verify that the normal temperature placement of one month will not affect the biological activity of powder products. After collecting, please store the product according to the requirements described in the datasheet. Most Selleck products are stable under the recommended conditions.

NOT FOR HUMAN, VETERINARY DIAGNOSTIC OR THERAPEUTIC USE.